Journal of Animal Breeding and Genomics (J Anim Breed Genom)
1Department of Animal Science, Chungnam National University, Daejeon 34134, Korea
2Department of Bio-AI Convergence, Chungnam National University, Daejeon 34134, Korea
*Correspondence to Jun Heon Lee, E-mail: junheon@cnu.ac.kr
Volume 9, Number 2, Pages 49-55, June 2025.
Journal of Animal Breeding and Genomics 2025, 9(2), 49-55. https://doi.org/10.12972/jabng.2025.9.2.1
Received on December 06, 2024, Revised on April 08, 2025 , Accepted on June 09, 2025, Published on June 30, 2025.
Copyright © 2025 Korean Society of Animal Breeding and Genetics.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0).
Indigenous chickens, such as Korean native chickens (KNCs), are known for possessing higher disease resistance compared to commercial chickens. Avian influenza virus (AIV) is an enveloped, negative-sense, single-stranded RNA virus that infects avian species and other hosts, causing respiratory illness and significant economic losses. Previous studies have demonstrated that a 33-aminoacid sequence unique to chickens within the ANP32A gene is critical for supporting AIV RNA polymerase (vPol) activity. This study aims to investigate genetic variants across the entire region of the ANP32A gene, including the avian-specific insertion, using nextgeneration sequencing (NGS) and Sanger sequencing in six KNC lines. NGS analysis of 60 individuals identified a total of 510 variants within the ANP32A gene region, including eight located in exon regions. Among these, two frameshift variants (rs733744684 C>CTCTGG, rs732131973 ACT>A) were identified, both of which may lead to a loss of protein function. Sanger sequencing of 18 individuals revealed 10 variants, including three that overlapped with the NGS results. A synonymous variant (rs733980419 G>A), located at position 134N within the chicken-specific insertion, was consistently detected in all KNC lines. These investigations emphasize the genetic diversity of the ANP32A gene in KNCs and suggest a potential role for mutations in modulating susceptibility to AIV. This study provides valuable insights into the genetic basis of AIV resistance and establishes a foundation for future breeding strategies aimed at enhancing AIV resilience in KNC populations.
Korean native chicken, Avian influenza, ANP32A gene, Next generation sequencing, Sanger sequencing
한국 재래닭(Korean native chicken, KNC)은 오랜 시간 동안 지역 환경에 적응하며 자연선택을 통해 형성된 고유 유전자원으로, 강건성과 질병 저항성이 뛰어난 것으로 널리 알려져 있다(Manjula et al., 2020). 한국에서는 닭을 상업 품종과 재래닭으로 구분하며, KNC는 5개의 품종 및 12개의 계통으로 세분화된다. 특히, 주요 6개 재래종 계통은 흰색(KNC-W), 검정색(KNC-B), 황갈색(KNC-Y), 회갈색(KNC-G), 적갈색(KNC-R), 오계(KNC-O)로 분류된다(Cho et al., 2023). KNC는 상업용 육계에 비해 성장 속도는 느리지만, 저지방·고단백 육질로 인해 국내 소비자들에게 높은 선호도를 보이고 있다(Kong et al., 2006; Manjula et al., 2020).
조류인플루엔자 바이러스(avian influenza virus, AIV)는 주로 가금류에 감염되지만 다양한 종으로 확산될 수 있는 인수공통감염병 병원체로, 수의 및 공중보건 분야에 심각한 위협을 초래한다(Peacock et al., 2020). AIV는 돌연변이율이 높은 음성 단일 가닥 RNA 바이러스로, 매년 약 1,000개 뉴클레오타이드 당 2 ~ 8개의 변이가 발생한다. AIV는 hemagglutinin (HA, H1 ~ H5)과 neuraminidase (NA, N1 ~ N9) 조합에 따라 아형이 구분되며, 병원성에 따라 고병원성(high pathogenic avian influenza, HPAI)과 저병원성(low pathogenic avian influenza, LPAI)으로 나뉜다(Alexander, 2007). HPAI 균주, 특히 H5형과 H7 아형은 매우 높은 병원성을 나타내며, 치사율이 거의 100%에 달하는 것으로 보고되고 있다. 반면, LPAI 균주는 증상이 경미하거나 없지만, 산란계에서 우울증이나 산란율 감소와 같은 생산성 저하를 유발할 수 있다(Capua and Alexander, 2004).
AIV의 RNA 중합효소 복합체(vPol)는 polymerase basic protein 1 (PB1), polymerase basic protein 2 (PB2), polymerase acidic protein (PA)로 구성되며, 숙주 세포의 acidic nuclear phosphoprotein 32-kDa (ANP32) 단백질 계열의 지원이 필요하다(Nilsson-Payant et al., 2022; Idoko-Akoh et al., 2023). ANP32 단백질은 진핵세포에서 바이러스 복제의 주요 기질로 작용하며, 인간은 ANP32A, B, C, D, E 단백질을 보유하고 있는 반면, 닭에는 ANP32A, B, E 단백질만 존재한다. 이 중 ANP32A는 AIV 복제에 직접적으로 관여하는 주요 인자로 확인되었다(Matilla and Radrizzani, 2005). 특히, 닭의 ANP32A 유전자가 암호화하는 ANP32A 단백질은 포유류에는 존재하지 않는 33개 길이의 아미노산 서열을 추가로 포함하고 있다. 이 서열은 N-말단의 류신 반복 영역(n-terminal leucine-rich region, LRR)과 C-말단의 저복합성 산성 영역(c-terminal low-complexity acidic region, LCAR) 사이에 위치하며, AIV의 RNA 중합효소와 결합하는 데 중요한 역할을 한다. 반면, 포유류에는 해당 서열이 존재하지 않아 상대적으로 AIV 감염 위험이 낮은 것으로 알려져 있다(Sun et al., 2025). 이러한 서열 차이는 닭에서 ANP32A 유전자가 AIV RNA 중합효소의 활성을 도우며, 결과적으로 닭의 AIV 감염률 상승에 중요한 역할을 한다.
한국에서는 2003년부터 2014년까지 H5N1형 및 H5N8형 HPAI가 5차례 발생하여 가금 산업에 막대한 경제적 손실을 초래하였다(Lee et al., 2017). 이를 예방하기 위해 백신 접종이 널리 활용되고 있으나, 실제 현장에서는 그 효과가 제한적인 것으로 보고되고 있다(Lee et al., 2011; Fujimoto et al., 2025). 이에 따라 닭에서 AIV를 감염률을 감소시키기 위한 다른 방법으로 바이러스 복제와 관련된 유전자 서열의 삭제 또는 저항성과 관련된 유전자의 도입과 유전체 편집 연구들이 활발히 이뤄지고 있다(Hunter et al., 2005; Chen et al., 2008; Sugiyama et al., 2015). 최근 연구에서는 ANP32A의 129번과 130번 위치에서 각각 asparagine (N)과 aspartic acid (D)를 암호화하는 코돈을 isoleucine (I)과 asparagine (N)을 암호화하도록 치환하는 CRISPR-cas9 기반 유전자 편집 기술을 통해, AIV의 복제 효율을 유의하게 감소시킬 수 있음을 보고하였다 (Idoko-Akoh et al., 2023). 이러한 상황을 고려할 때, 한국 재래닭 집단의 보존 및 개량을 위한 전략으로, AIV에 대한 선천적 저항성을 갖는 개체의 선발과 그 유전적 기반에 대한 분석 연구의 필요성이 점차 강조된다.
따라서, 본 연구에서는 AIV의 관련 유전자로 알려진 ANP32A 유전자의 변이를 조사하여 상업 품종보다 강건성이 우수한 것으로 평가되는 한국 재래닭의 AIV 저항성과 관련된 유전적 요인을 규명하는 것을 목표로 한다.
본 연구는 국립축산과학원 가금연구센터 동물실험윤리위원회의 승인을 받았으며 혈액 샘플 수집 절차는 국립축산과학원 가금연구센터의 윤리 승인 번호 2012-C-037에 따라 수행되었다.
본 연구에서는 회갈색(KNC-G), 적갈색(KNC-R), 황갈색(KNC-Y), 검정색(KNC-B), 흰색(KNC-W), 오계(KNC-O) 총 6개 계통에서 각각 10마리씩, 총 60마리를 대상으로 ANP32A 유전자의 single nucleotide polymorphism (SNP)를 식별하고 검증하였다. 이를 위해 해당 계통의 next-generation sequencing (NGS) 데이터는 National agricultural biotechnology information center (NABIC, https://nabic.rda. go.kr/)의 데이터를 활용하였다. QC 과정을 거친 후 시퀀스 리드는 GATK best practices 파이프라인을 따라 reference genome (Ensembl_ GRCg6a)에 매핑되었다(De Summa et al., 2017). 최종적으로 확인된 변이는 SnpEff를 사용하여 필터링 되었고 각 변이가 위치한 유전자 정보를 확인하였다(Cingolani et al., 2012).
본 연구에서는 국립축산과학원의 KNC 6개 계통에서 각각 3마리씩, 총 18마리의 혈액 시료로부터 DNA를 prime prep genomic DNA extraction kit (GenetBio Co., Daejeon, Korea)를 사용하여 추출하였다. 닭 ANP32A 유전자의 전체 exon영역(Ensembl ID: ENSGALG00000008054, reference genome GRCg6a)을 대상으로 하는 9쌍의 프라이머를 NCBI 데이터베이스의 primer BLAST를 사용하여 설계하였다(Ye et al., 2012) (Table 1). 중합효소 연쇄반응(polymerase chain reaction, PCR)은 20 μL의 반응 혼합물로 수행되었으며, DNA 2 μL (25ng/μL), 정방향 및 역방향 프라이머 각 1 μL, 3차 증류수 6 μL, HS premix (10x) (GenetBio Co., Daejeon, Korea) 10 μ L로 구성되었다. PCR 증폭조건은 다음과 같이 수행되었다. 95°C에서 3분간 열 변성을 시킨 후, 95°C에서 30초, 59.6°C ~ 65.2°C에서 45초, 72°에서 45초를 1회로 35 ~ 37회 반응을 수행하였다. 최종 증폭은 72°C에서 10분간 수행하였다. 증폭된 PCR 산물은 2% agarose gel에 ethidium bromide를 첨가하여 전기영동(electrophoresis)으로 분석하였다. 전기영동은 100V에서 45분간 수행되었으며, 증폭된 산물은 UV transilluminator를 통해 확인하였다. PCR amplification은 purification 후 Sanger 시퀀싱 데이터를 분석하는 데 사용되었다.
Table 1. Primer sets used for PCR
| Primer | Sequence (5′–3′) | Size (bp) | Genome position | Tm (℃) |
|---|---|---|---|---|
| ANP32_F1 | CGCACCTCTTATTGGCAACG | 1,459 | 19,695,648 – 19,697,107 | 64.0 |
| ANP32_R1 | CTCTCCCTCGCAATCGTTGT | |||
| ANP32_F2 | GTCAGCCACTGGTGTTGTG | 528 | 19,694,379 – 19,694,907 | 60.6 |
| ANP32_R2 | CGTGAGTCCACCAAACGGC | |||
| ANP32_F3 | AGAGTGGCAGGGCCTGCAT | 829 | 19,689,035 – 19,689,863 | 62.0 |
| ANP32_R3 | GCAGGTGACTACAAGAGATTGTGT | |||
| ANP32_F4 | TGCTGTCAGGGTTGTCATTG | 725 | 19,685,298 – 19,686,023 | 59.6 |
| ANP32_R4 | CTGCCGTGCGTTGCTCTTT | |||
| ANP32_F5 | AGCAAATAAGGGTGAGGCAGGA760 | 760 | 19,682,674 – 19,683,434 | 59.6 |
| ANP32_R5 | CTGTTAGGTGTCAGGCAGATA | |||
| ANP32_F6 | TTCTGCCCTCACTTTGGAGGC | 881 | 19,680,735 – 19,681,616 | 65.2 |
| ANP32_R6 | ACTCCCCTGATCTGCAAATAT | |||
| ANP32_F7 | ACTTGGTGCACACTGTTCCA | 421 | 19,679,150 – 19,679,571 | 59.6 |
| ANP32_R7 | ACAAGAGGACACCCCACGTGA | |||
| ANP32_F8 | CTGAAGATGCCTGACGTTGC | 475 | 19,678,135 – 19,678,610 | 60.5 |
| ANP32_R8 | GAAGACTCTCCACAGGTGCT | |||
| ANP32_F9 | AGCAGCATCTGATTTTTCATCC | 655 | 19,677,569 – 19,678,223 | 64.8 |
| ANP32_R9 | CCTAGATTGTGAGCACCCCC |
ANP32, Acidic nuclear phosphoprotein 32-kDa; PCR, Polymerase chain reaction
ANP32A 유전자 영역에서는 총 510개의 변이가 확인되었으며, 해당 변이들은 intergenic 영역 4개, exon 영역 8개, intron 영역 102개, UTR 영역 24개, upstream 영역 303개, 그리고 downstream 영역에서 69개가 확인되었다. exon 영역의 확인된 8개의 변이는 2개의 frameshift 변이(rs733744684 C>CTCTGG, rs732131973 ACT>A), 2개의 missense 변이(rs318224693 G>A, chr10:19689513 G>A), 4개의 synonymous 변이(rs741217051 G>A, rs315826671 G>A, rs733980419 G>A, rs738788312 G>A)로 확인되었다(Table 2, Table 3). Frameshift 변이인 rs733744684 C>CTCTGG와 rs732131973 ACT>A은 open reading frame (ORF)을 변화시켜 종결 코돈 또는 비정상적인 아미노산 서열을 유도함으로써, ANP32A 유전자의 구조 및 기능에 영향을 미칠 수 있을 것으로 예상된다. 이러한 변이는 유전자의 기능을 불활성화 할 가능성이 높으며, 따라서 이에 대한 후속 연구가 요구된다(Genes, 2004; MacArthur et al., 2012; Stenson et al., 2017).
Table 2. Variants detected in 60 KNCs using NGS
| Position(bp)* | ID | Ref | Alt | Variant type |
|---|---|---|---|---|
| 19,689,213 | rs733744684 | C | CTCTGG | Frameshift |
| 19,689,541 | rs732131973 | ACT | A | Frameshift |
| 19,677,796 | rs318224693 | G | A | Missense |
| 19,689,513 | – | G | A | Missense |
| 19,679,390 | rs741217051 | G | A | Synonymous |
| 19,680,997 | rs315826671 | C | T | Synonymous |
| 19,681,326 | rs733980419 | G | A | Synonymous |
| 19,681,395 | rs738788312 | G | A | Synonymous |
KNC, Korean native chicken; NGS; Next generation sequencing; Ref, Reference; Alt, Alternative; *, Located on chicken chromosome 10
Table 3. NGS-based analysis of variants across KNC lines
| Position(bp)* | ID | KNC-G | KNC-B | KNC-R | KNC-Y | KNC-W | KNC-O |
|---|---|---|---|---|---|---|---|
| 19,689,213 | rs733744684 C>CTCTGG | 0 | 1 | 0 | 0 | 0 | 0 |
| 19,689,541 | rs732131973 ACT>A | 1 | 0 | 0 | 0 | 0 | 3 |
| 19,677,796 | rs318224693 G>A | 0 | 0 | 0 | 1 | 0 | 0 |
| 19,689,513 | – | 0 | 0 | 3 | 0 | 1 | 0 |
| 19,679,390 | rs741217051 G>A | 0 | 1 | 0 | 0 | 0 | 0 |
| 19,680,997 | rs315826671 C>T | 4 | 1 | 9 | 8 | 5 | 6 |
| 19,681,326 | rs733980419 G>A | 10 | 9 | 4 | 4 | 9 | 6 |
| 19,681,395 | rs738788312 G>A | 0 | 3 | 3 | 0 | 5 | 0 |
KNC, Korean native chicken; NGS, Next generation sequencing; *, Located on chicken chromosome 10
KNC 6개 계통의 18마리 샘플을 대상으로 ANP32A 유전자의 전체 12개 exon을 분석한 결과, 총 10개의 변이가 확인되었다. 구체적으로 exon 3에서 4개의 5′-untranslated region (UTR)변이(rs13704383 G>A, rs13704382 G>A, rs13704381 T>C, rs316166643 G>A, rs317369619 T>C), exon 5에서 1개의 intron 변이(rs314407990 T>A), exon 8에서 2개의 synonymous 변이(rs733980419 G>A, rs738788312 G>A), exon 9에서 1개의 synonymous 변이(rs315826671 T>C), exon 12에서 missense 변이 1개(rs318224693 G>A)가 확인되었다(Table 4, Table 5). 이 중 exon 8번에 위치한 rs733980419 G>A 변이는 닭에만 특이적으로 존재하는 아미노산 서열 중 134번 위치의 134N (asparagine)에 해당하는 것으로 확인되었다. 분석 결과, 해당 변이는 synonymous 변이로 아미노산 서열의 변화를 유발하지는 않는 것으로 확인되었다. 최근 해당 변이가 단백질 발현 조절이나 특정 질병 기전에 기여할 가능성이 있다고 보고되고 있다(Sauna and Kimchi-Sarfaty, 2011; Chu and Wei, 2019).
본 연구에서는 ANP32A 유전자의 전체 exon을 대상으로 변이를 확인하였으며, AIV 결합 지역과 함께 닭 특이적인 주요 지역의 변이를 탐색하였다(Idoko-Akoh et al., 2023; Park et al., 2021). 연구 결과, 기존 유전자 편집 기반 연구에서 AIV 결합에 중요한 역할을 하는 것으로 확인된 129N (asparagine), 130D (aspartic acid), 149D (aspartic acid)와 152D (aspartic acid) 위치에서는 변이가 확인되지 않았다. 그러나 동일한 닭 특이적 서열 내에 위치한 134N (asparagine)에서 변이가 발견됨에 따라 해당 위치 역시 AIV 감염성에 관여할 가능성이 있으며, 향후 유전자 편집 기술 등을 활용한 검증을 통해 AIV에 저항성을 가진 개체 개발의 방법으로 고려될 수 있을 것이다.
Table 4. Variants identified in 18 KNCs using Sanger sequencing
| Exon | Position(bp)* | ID | Ref | Alt | Variant type |
|---|---|---|---|---|---|
| 3 | 19,689,698 | rs13704383 | G | A | 5′ UTR |
| 3 | 19,689,632 | rs13704382 | G | A | 5′ UTR |
| 3 | 19,689,606 | rs13704381 | T | C | 5′ UTR |
| 3 | 19,689,599 | rs316166643 | G | A | 5′ UTR |
| 3 | 19,689,589 | rs317369619 | T | C | 5′ UTR |
| 5 | 19,685,610 | rs314407990 | T | A | Intron |
| 8 | 19,681,326 | rs733980419 | G | A | Synonymous |
| 8 | 19,681,395 | rs738788312 | G | A | Synonymous |
| 9 | 19,680,997 | rs315826671 | T | C | Synonymous |
| 12 | 19,677,796 | rs318224693 | G | A | Missense |
KNC, Korean native chicken; UTR, Untranslated region; Ref, Reference; Alt, Alternative; *, Located on chicken chromosome 10
Table 5. Sanger sequencing-based analysis of variants across KNC lines
| Position(bp)* | ID | KNC-G | KNC-B | KNC-R | KNC-Y | KNC-W | KNC-O |
|---|---|---|---|---|---|---|---|
| 19,689,698 | rs13704383 G>A | 2 | 1 | 3 | 3 | 2 | 1 |
| 19,689,632 | rs13704382 G>A | 1 | 0 | 2 | 2 | 2 | 0 |
| 19,689,606 | rs13704381 T>C | 2 | 0 | 2 | 1 | 2 | 0 |
| 19,689,599 | rs316166643 G>A | 1 | 0 | 2 | 0 | 1 | 0 |
| 19,689,589 | rs317369619 T>C | 3 | 1 | 2 | 3 | 2 | 0 |
| 19,685,610 | rs314407990 T>A | 3 | 3 | 3 | 3 | 3 | 0 |
| 19,681,326 | rs738788312 T>A | 0 | 0 | 1 | 1 | 2 | 1 |
| 19,681,395 | rs733980419 G>A | 2 | 2 | 2 | 2 | 2 | 1 |
| 19,680,997 | rs315826671 T>C | 2 | 2 | 1 | 2 | 2 | 0 |
| 19,677,796 | rs318224693 G>A | 0 | 0 | 0 | 1 | 0 | 0 |
KNC, Korean native chicken; UTR, Untranslated region; *, Located on chicken chromosome 10
NGS와 Sanger 시퀀싱 결과를 비교한 결과, 두 방법에서 동일한 변이가 일부 확인되었다. 공통으로 확인된 변이는 2개의 synonymous 변이(rs733980419 G>A, rs738788312 G>A)와 1개의 missense 변이(rs318224693 G>A)로 확인되었다(Table 3, Table 5). 이 중 2개의 synonymous 변이는 KNC 모든 계통에서 공통적으로 확인되었다. 이러한 결과는 해당 변이가 KNC 집단 내에서 오랜 기간에 걸쳐 유전적으로 고정되었거나, 자연 선발 과정을 통해 유지된 특징일 것이라 추측된다. 이러한 특성은 KNC의 강건성과 관련된 유전적 기반을 탐색하는 데 있어 유용한 기초 자료로 활용될 수 있을 것이다.
반면, frameshift 변이로 확인된 rs733744684 C>CTCTGG와 rs732131973 ACT>A는 NGS 데이터의 일부 시료에서만 발견되었으며, Sanger 시퀀싱에서는 확인되지 않았다(Table3, Table 5). 이러한 차이는 두 변이가 낮은 빈도로 존재하는 희귀 변이일 가능성이 있으며, Sanger 시퀀싱에 사용한 시료의 수가 제한적이었기 때문으로 판단된다. 향후 보다 많은 시료를 확보하여 해당 변이들의 분포 및 빈도를 검증할 필요가 있을 것이다.
본 연구 결과는 ANP32A 유전자가 닭의 AIV 감염에서 중요한 역할을 할 수 있음을 시사한다. 특히, 해당 유전자는 특정 변이를 통해 AIV 감염을 억제 유전자로 작용할 가능성이 제기되었다. 또한, 본 연구에서는 신규 변이 및 AIV vPol 결합 부위와 인접한 위치에서 유의미한 변이가 확인되었다. 이는 ANP32A 유전자의 조류독감 바이러스 발현 조절 기전과 감염 정도에 미치는 잠재적 영향을 시사한다(Nilsson-Payant et al., 2022; Idoko-Akoh et al., 2023).
다만, 본 연구는 유전자 편집을 통한 변이의 기능적 검증을 수행하지 못했다는 한계가 존재한다. 예를 들어, 본 연구에서 확인된 synonymous rs733980419 G>A 변이에 대해 유전자 편집을 통해 감염성 변화 여부를 확인하는 연구는 이루어지지 않았다. 또한, NGS 및 Sanger 시퀀싱에서 동일한 시료를 사용하지 못했고, 시료 수가 제한적이었기 때문에 직접적인 비교 분석에 어려움이 있었다.
그럼에도 불구하고 본 연구는 KNC 집단에서 AIV 감염력에 영향을 미치는 ANP32A 유전자 변이의 기전을 이해하는 데 기초 자료를 제공하며, 질병 저항성을 가진 개체 육종 전략 수립 및 마커 개발을 위한 자료로 활용될 수 있을 것으로 기대된다.
No potential conflict of interest relevant to this article is reported.
이 논문은 2022년도 정부(과학기술정보통신부)의 재원으로 한국연구재단의 지원(No.2022 R1F1A1064025)과 2021년도 농촌진흥청의 지원을 받아 수행된 연구임(RS-2021-RD010125(PJ016205)).
Alexander DJ. 2007. An overview of the epidemiology of avian influenza. Vaccine 25: 5637-5644.
[DOI][PubMed]
Capua I,Alexander DJ. 2004. Avian influenza: recent developments. Avian Pathology 33: 393-404.
[DOI][PubMed]
Chen J, Chen SC-Y, Stern P, Scott BB,Lois C. 2008. Genetic strategy to prevent influenza virus infections in animals. The Journal of infectious diseases 197: S25-S28.
[DOI][PubMed][PMC]
Chen R,Holmes EC. 2006. Avian influenza virus exhibits rapid evolutionary dynamics. Molecular biology and evolution 23: 2336-2341.
[DOI][PubMed]
Cho E, Kim M, Kim J-H, Roh H-J, Kim SC, Jin D-H, Kim DC,Lee JH. 2023. Application of genomic big data to analyze the genetic diversity and population structure of Korean domestic chickens. Journal of Animal Science and Technology 65: 912.
[DOI][PubMed][PMC]
Chu D,Wei L. 2019. Nonsynonymous, synonymous and nonsense mutations in human cancer-related genes undergo stronger purifying selections than expectation. BMC cancer 19: 1-12.
[DOI][PubMed][PMC]
Cingolani P, Platts A, Wang LL, Coon M, Nguyen T, Wang L, et al. 2012. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly 6: 80-92.
[DOI][PubMed][PMC]
De Summa S, Malerba G, Pinto R, Mori A, Mijatovic V, Tommasi S. 2017. GATK hard filtering: tunable parameters to improve variant calling for next generation sequencing targeted gene panel data. BMC Bioinformatics 18: 119.
[DOI][PubMed][PMC]
Fujimoto Y, Ozaki K,Ono E. 2025. Chicken ANP32A-independent replication of highly pathogenic avian influenza viruses potentially leads to mammalian adaptation-related amino acid substitutions in viral PB2 and PA proteins. Journal of virology 99: e01840-24.
[DOI][PubMed][PMC]
Genes P-C. 2004. A Systematic Survey of Loss-of-Function Variants in Human. Science 304: 1663.
Hunter CV, Tiley LS,Sang HM. 2005. Developments in transgenic technology: applications for medicine. TRENDS in molecular medicine 11: 293298.
[DOI][PubMed]
Idoko-Akoh A, Goldhill DH, Sheppard CM, Bialy D, Quantrill JL, Sukhova K, Brown JC, Richardson S, Campbell C,Taylor L. 2023. Creating resistance to avian influenza infection through genome editing of the ANP32 gene family. Nature communications 14: 6136.
[DOI][PubMed][PMC]
Kong H, Oh J, Lee J, Jo K, Sang B, Choi C, Kim S, Lee S, Yeon S, Jeon G. 2006. Genetic variation and relationships of Korean native chickens and foreign breeds using 15 microsatellite markers. Asian-australasian journal of animal sciences 19: 1546-1550.
[DOI]
Lee EK, Kang HM, Song BM, Lee YN, Heo GB, Lee HS, Lee YJ,Kim JH. 2017. Surveillance of avian influenza viruses in South Korea between 2012 and 2014. Virology journal 14: 1-10.
[DOI][PubMed][PMC]
Lee YN, Lee DH, Park JK, Lim TH, Youn HN, Yuk SS, Lee YJ, Mo IP, Sung HW, Lee JB. 2011. Isolation and characterization of a novel H9N2 influenza virus in Korean native chicken farm. Avian diseases 55: 724-727.
[DOI][PubMed]
Long JS, Mistry B, Haslam SM,Barclay WS. 2019. Host and viral determinants of influenza A virus species specificity. Nature Reviews Microbiology 17: 67-81.
[DOI][PubMed]
MacArthur DG, Balasubramanian S, Frankish A, Huang N, Morris J, Walter K, Jostins L, Habegger L, Pickrell JK, Montgomery SB, et al. 2012. A systematic survey of loss-of function variants in human protein-coding genes. Science 335: 823-828.
[DOI][PubMed][PMC]
Manjula P, Fulton JE, Seo D,Lee JH. 2020. Major histocompatibility complex B variability in Korean native chicken breeds. Poultry science 99: 4704-4713.
[DOI][PubMed][PMC]
Matilla A,Radrizzani M. 2005. The Anp32 family of proteins containing leucine-rich repeats. The Cerebellum 4: 7-18.
[DOI][PubMed]
Nilsson-Payant BE, TenOever BR,te Velthuis AJ. 2022. The host factor ANP32A is required for influenza A virus vRNA and cRNA synthesis. Journal of virology 96: e02092-21.
[DOI][PubMed][PMC]
Park YH, Woo SJ, Chungu K, Lee SB, Shim JH, Lee HJ, Kim I, Rengaraj D, Song CS,Suh JY. 2021. Asp149 and Asp152 in chicken and human ANP32A play an essential role in the interaction with influenza viral polymerase. The FASEB Journal 35: e21630.
[DOI][PMC]
Peacock TP, Swann OC, Salvesen HA, Staller E, Leung PB, Goldhill DH, Zhou H, Lillico SG, Whitelaw CBA,Long JS. 2020. Swine ANP32A supports avian influenza virus polymerase. Journal of virology 94: 10.1128/jvi.00132-20.
[DOI][PubMed][PMC]
Sauna ZE,Kimchi-Sarfaty C. 2011. Understanding the contribution of synonymous mutations to human disease. Nature Reviews Genetics 12: 683691.
[DOI][PubMed]
Stenson PD, Mort M, Ball EV, Evans K, Hayden M, Heywood S, Hussain M, Phillips AD,Cooper DN. 2017. The Human Gene Mutation Database: towards a comprehensive repository of inherited mutation data for medical research, genetic diagnosis and next-generation sequencing studies. Human genetics 136: 665-677.
[DOI][PubMed][PMC]
Sugiyama K, Kawaguchi A, Okuwaki M,Nagata K. 2015. pp32 and APRIL are host cell-derived regulators of influenza virus RNA synthesis from cRNA. Elife 4: e08939.
[DOI][PubMed][PMC]
Sun L, Qu Y, Wang XF, Yu M, Wang X. 2025. Functional redundancy in chicken ANP32A mediates species-specific support of avian influenza virus polymerase. bioRxiv. https://doi.org/10.1101/2025.03.25.645163.
[DOI]
Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. 2012. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC bioinformatics 13: 1-11.
[DOI][PubMed][PMC]